[![Build Status](https://travis-ci.org/wang-q/AlignDB-DeltaG.svg?branch=master)](https://travis-ci.org/wang-q/AlignDB-DeltaG) [![Coverage Status](http://codecov.io/github/wang-q/AlignDB-DeltaG/coverage.svg?branch=master)](https://codecov.io/github/wang-q/AlignDB-DeltaG?branch=master) [![MetaCPAN Release](https://badge.fury.io/pl/AlignDB-DeltaG.svg)](https://metacpan.org/release/AlignDB-DeltaG) # NAME AlignDB::DeltaG - Calculate deltaG of polymer DNA sequences # SYNOPSIS - Normal use use AlignDB::DeltaG my $deltaG = AlignDB::DeltaG->new( temperature => 37, salt_conc => 1, ); my $seq = "TAACAAGCAATGAGATAGAGAAAGAAATATATCCA"; print "$seq deltaG: ", $deltaG->polymer_deltaG($seq), "\n"; - Reset conditionss use AlignDB::DeltaG; # default value: # temperature => 37, # salt_conc => 1, my $deltaG = AlignDB::DeltaG->new; $deltaG->temperature(30); $deltaG->salt_conc(0.1); $deltaG->BUILD; my $seq = "TAACAAGCAATGAGATAGAGAAAGAAATATATCCA"; print "$seq deltaG: ", $deltaG->polymer_deltaG($seq), "\n"; # DESCRIPTION `AlignDB::DeltaG` is a simple class to calculate deltaG of polymer DNA sequences using the NN model. In the near future, it may be extanded to calculate oligonucleotide thermodynamics. ## Reference 1. SantaLucia J, Jr. 2004. Annu Rev Biophys Biomol Struct; 2. SantaLucia J, Jr. 1998. Proc Natl Acad Sci U S A; # ATTRIBUTES `temperature` - default: 37.0 degree centigrade `salt_conc` - salt concentration, Default: 1 \[Na+\], in M. Should be above 0.05 M and below 1.1 M `deltaH` - enthalpy, isa HashRef `deltaS` - entropy (cal/K.mol), isa HashRef `deltaG` - free energy, isa HashRef # METHODS ## BUILD rebuild the object by the new temperature and/or salt\_conc values ## polymer\_deltaG my $dG = $obj->polymer_deltaG($seq); Calculate deltaG of a given sequence. This method is the main calculating sub. # AUTHOR Qiang Wang <wang-q@outlook.com> # COPYRIGHT AND LICENSE This software is copyright (c) 2008 by Qiang Wang. This is free software; you can redistribute it and/or modify it under the same terms as the Perl 5 programming language system itself.